Multiplex PCR: Quick and accurate detection of Bacillary Necrosis

Multiplex PCR is an accurate method of medical diagnosis that has prospect in developing sustainable pangasius industry.

Multiplex PCR is an accurate method of medical diagnosis that has a prospect in developing a sustainable pangasius industry.

The Multiplex PCR method (multi-bait PCR) detects quickly and accurately the bacteria Edwardsiella ictaluri, a cause of Bacillary Necrosis in pangasius (Pangasianodon hypophthalmus)

At present, pangasius (Pangasianodon hypophthalmus) is one of the primary aquatic species in our country. The rapid expansion of the industrial farming scale is a cause for increasing of disease caused by the fungus Achya sp., the blood infection caused by the bacteria Aeromonas hydrophila. Among them, hepatopathy caused by the bacterium Edwardsiella ictaluri can be as high as 90-100%, depending on the management and size of the fish. Due to the lack of timely detection and quantification of chemicals and antibiotics used correctly, the phenomenon of resistance to antibiotics such as streptomycine, tetracycline has emerged. Therefore, the need for timely detection methods of hepatobiliary disease in pangasius is very essential.

The identification of E. ictaluri bacteria mostly uses traditional biochemical methods. Because this bacteria grows up in synthetic culture environment for 48 hours at 28oC, isolation, culture and identification last about 4-7 days. Diagnosis takes a long time so it does not meet the need to propose treatment solutions for fish ponds. Therefore, it is necessary to develop a quick and accurate diagnosis of this bacterium

Recently, researchers at Ho Chi Minh City University of Food Industry have completed research on “discovery of the bacterium Edwardsiella ictaluri that causes GTM on pangasius (Pangasius hypophthalmus) by Multiplex PCR method” to facilitate quick detection of GTM to have timely interventions and reduce the risks. At the same time, creating a premise for the development of quick testing kits for E. ictaluri on pangasius. Multiplex PCR method detects E. ictaluri bacteria

Implementation process:

  1. Acquire and extract genome DNA of E. ictaluri bacteria
  2. Investigate the sensitivity of specific primers
  3. Isolate and collect infected samples of pangasius
  4. Perform Multiplex PCR procedure on DNA extracted from samples

Principles of Multiplex PCR:

Principles of Multiplex PCR (source: http://www.premierbiosoft.com/)

With only one PCR reaction but many DNA sequences are amplified (multiple sequences are amplified simultaneously using many primers, all components are added into one est tube). Design a specific primer is very important due to the implementation of multiple reflections in a tube, avoid cross-coupled primers to form dimer primers leading to non-specific amplification. Primers can be designed by PrimerPlex software for multiplex PCR reactions.

In the above study, the researchers used 3 pairs of amplified primers corresponding to 3 genes on pangasius:

Gene Primer code Primer sequence (5’ – 3’) Product
SerC FserC/RserC F: TCTGGTTGGCCGAATATGGACTC

R: CGTAATCAAACCAACACCGGGTATT

191bp
16S rRNA EiFd/EiRs F: GTAGCAGGGAGAAAGCTTGC

R: GAACGCTATTAACGCTCACACC

407bp
Eip18 Eip 18F/ Eip 1R F: GATGGGGAATCTACTGATGC

R: TAAGACTCCAGCCCTCGG

480bp

 

After investigating specific primers, the FserC / RserC and EiFd / EiRs primers were chosen to perform Multiplex PCR. Results from more than 20 DNA samples extracted from patient samples.

Positive control is well 21, a negative control is well 22, M: DNA marker. Well number 5,6 does not appear so this sample is negative. Whereas samples 2,4 and 16 appear only one line of the 191 bp line for the FserC / RserC primer pair. These wells show positive for E. ictaluri. Thus, for a total of 20 fish samples tested, 90% of the samples were positive for E. ictaluri and 10% of the samples were negative.

As we have seen, if we only use traditional PCR with 1 primer pair, the probability of false-negative is very high, the sensitivity of the reaction had been increased thanks to multiplex PCR that help to detect bacteria more accurately. Besides, to improve the reaction, researchers should use internal control to ensure there is no error in the implementation of the reactions.

Generally, with two specific pairs of FserC / RserC and EiFd / EiRs primers, the multi-primer PCR reaction helps to detect Edwardsiella ictaluri bacteria causing hepatopathy in pangasius. Within a total of 20 pangasius samples collected in Dong Thap province, the infection rate was 90%. The template DNA concentration used for pathogen detection is 20ng / µL. The use of multi-primer PCR will help overcome the phenomenon of false negative or false positives compared to single primer PCR. This study also paved the way for the production of PCR kit for rapid detection of the bacterium Edwardsiella ictaluri, a pathogen causes diseases in aquatic animals.

Source: tepbac.com

Leave a Comment

1